DNA Chain Letter
published on: 2/28/2003
Contributing Teacher(s): Scott McQuerry
Subject Area:
Science/Life Grade Range: Middle Grades (6-8), High School (9-12) Materials Needed:
Objective: By the end of this lesson, the students will be able to:
Process Standards:
- Goal 1.5 comprehend and evaluate written, visual and oral presentations and works
- Goal 3.6 examine problems and proposed solutions from multiple perspectives
Content Standards:
- Science 3. Characteristics and interactions of living organisms
- Communication Arts 4. Writing formally (such as reports, narratives, essays) and informally (such as outlines, notes)
Time Allowance: At least 6 weeks
Description: This activity engages the students in an authentic model for DNA replication, inheritance, mutation, and repair -- cells
Comments: Time allowance is at least 6 weeks to incorporate a class of 100 students. A shorter time is possible if the instructor has a smaller class or if the roster is modified in any way. The actual time for each individual student to participate within the activity is minimal, ranging from 1-5 minutes.
Classroom Component: Steps to Implement this Lesson: This activity must be initiated several weeks prior to the beginning of a unit on DNA. The construction of the chain letter and a team roster is all that is required. Samples for both the letter and the roster are provided. It is possible to amplify the students'' curiosities throughout this activity by adding an element of mystery at its beginning. By not informing them of the purpose of the chain letter, many students will be eager to participate. Assessment:
Activities and Procedures: In the first few days of school, I begin a chain letter with the students on my team. The letter''s message instructs the reader to make two handwritten copies and to pass them along to two different individuals listed on a team roster that I provide. Each of the two new letters is to be signed by the new author before their delivery. The original letter is then passed back to the instructor. This final step is crucial, as it provides evidence for the progression of the message and participation of the students throughout the roster. The instructions within the letter''s message informs the students that they are to replicate the copy they receive, character by character. Even if a word is misspelled within the text, the student is to copy the error within their reproductions. This procedure allows for the chain letter to be used as a model for DNA replication and the inheritance of mutations. When a student misspells a word, the subsequent students will perpetuate the error by copying it into their reproductions. Since each individual delivers two copies of the letter to different students, the error will spread exponentially throughout the rows of students. The error within the message of the text is analogous to a mutation within the DNA code. After each student participates with this activity, and the documents are spread out for them to observe, the students can map the path of errors that have been created and the mutation''s inheritance throughout successive "generations" of letters. Three different types of DNA mutations can be observed in this activity. Some mistakes are simple misspelled words (substitution mutations), or involve the addition of previously unwritten words (insertion mutations), or perhaps entail the removal of a word (deletion mutations.) Although the students may initially desire to "see who made the most mistakes," it remains an authentic tool for students to become engaged with an analogous model for DNA inheritance. At times, students overlook the instructions and correct the errors in the text. This, too, can be used as an educational model. This time, it models the actions of DNA repair. Just as mutations are being created, the cell''s repair enzymes are constantly working to fix any mutations that are discovered. Inadvertently, the students who have made these corrections have become a part of the chain letter model. This activity has elicited the same amount of interest among the student body for the past two years of its use. Accommodations: Size - Reduce the number of copies each individual is responsible for. Time - Increase the amount of time for students to copy and deliver their letter. Level of Support - Assign peer buddies to help students in their work. Input - Demonstrate the purpose behind the activity. Difficulty - Have students be the first in the roster to copy the letter; thus avoiding the spelling/grammatical errors that will exist after distribution through the roster. Output - Have another individual write for the student, while he/she dictates the letter. Participation - Students can send copy blindly to future students by having the instructor deliver the copies to other students. Alternate Goals - Accept letters without the ATGC''s. Substitute Curriculum - Instead of distributing the letters, some students may be learning alternate skills in the computer lab.A Student completes their copies and delivers the original letter to the instructor within a 24 hour period. B Student completes their copies and delivers the original letter to the instructor within a 24-48 hour period. C Student completes their copies and delivers the original letter to the instructor within a 48-72 hour period. D Student completes their copies and delivers the original letter to the instructor after a 72 hour period. F Student does not complete this activity, delivering no copies at all.
(Insert Date) Dear ________, If you are reading this letter, you have been successfully incorporated into our DNA project. Remember, it is very important to copy down everything on this letter exactly as you see it. You will handwrite two identical copies of this letter and send it to your designated contact individuals located on the student roster in class. Make certain to sign your name to each of these copies before you send them. If you do not have any such individuals, you are to handwrite two copies of this letter and deliver it, in person, to your teacher. Make certain this letter gets delivered to your teacher. ATCGGCTAAAGGCTTCAAGCGGGGGCTATATATAGCGCCCCGCGCTATCTAT CGATCAGATAGCTACGCTACGAGCTACGACTAGCATCGACGATACTAGCTAC TTCAAGCGGGGGCTATATATAGCGTTCAAGCGGGGGCTATATATAGCGCTAC Sincerely,Figure 1: Sample format for chain letter What do you think of this lesson? SuccessLink needs to know. Click HERE.
For additional information contact :
Scott McQuerry
Moreland Ridge Middle
Blue Springs R-IV
(816) 224-1800
EMAIL: msiphelp@cs.com

